Table 2. Transcripts with traces of an EcoRI related linker ctcgtgccgaattcggcacgag * and their supposed locations according to Genbank plus realted references.
# |
Accession / Organism |
Gene/Protein (Gene symbol) [notes for sides of linker (L or R)] |
Linker and its Amino Acids in Genbank |
Corresponding References According to Genbank; closest related match |
1 |
U58090 Homo sapiens |
Cullin gene family member, Hs-cul-4A |
aattcggcacgagctcgtgccgct NSARARAA |
Cell 85, 829-839. 1996. |
2 |
U28831 Homo sapiens |
Protein immuno-reactive with anti-PTH polyclonal antibodies |
gcacgagctcgtgccgat ARARAD |
Proc. Assoc. Am. Physicians 107, 296-305. 1995. |
3 |
BC041619 Homo sapiens |
Protein KIAA0404, for IMAGE:5923662 [R: hypoth. prot. MGC16044] |
ccctcgtgccgaattcggcacgag PSCRIRHE |
Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
4 |
AF176705 Homo sapiens |
F-box protein FBX10 (PINX1) [R: vector] |
cctcgtgccgaattc PRAEF |
Curr. Biol. 9, 1180-2. 1999. |
5 |
X85792 Homo sapiens |
Vpr binding protein 1 |
tcgtgccgaattcggcacgag SCRIRHE |
Benichou et al. [Unpublished]; J Biol Chem. 277, 45091-8. 2002 |
6 |
AF151109 Homo sapiens |
Putative BRCA1-interacting protein (BRIP1) |
ggcacgagctcgtgccgc GTSSCR |
Wang et al. BRCA1-interacting protein. [Unpublished]; Oncogene 19, 6152-8. 2000. |
7 |
AF146697 Homo sapiens |
FOXP1 |
aagaattcggcacgagct KNSARA |
Cancer Res. 61, 8820-8829. 2001. |
8 |
NM_002342 Homo sapiens |
Gene and 3' UTR for TNFR superfamily, member 3 (LTBR) |
gctcgtgccgaattc |
Genomics 16, 214-218. 1993. [Curated by NCBI] |
9 |
X93499 Homo sapiens |
RAB7 protein, GTP-binding [L: Dystroglycan 1. C: Rab7. R: Envelope glycoprotein] |
ccccgaattcgggg & gcccgaattcgggc |
Biochem. Biophys. Res. Commun. 229, 887-890. 1996. |
10 |
X82200 Homo sapiens |
Gene and mRNA for interferon-induced Staf50 |
gaattcggcacgagctc |
J. Biol. Chem. 270, 14891-14898. 1995. |
11 |
U31384 Homo sapiens |
mRNA for G protein gamma-11 subunit |
ggcacgagctcgtgccg |
J. Biol. Chem. 270, 21765-21771. 1995. |
12 |
AF379619 Homo sapiens |
Intron near AB13, precursor mRNA |
gaattcggcacgagct |
van Roy and Staes. New human gene family. [Unpublished]. |
13 |
AY245868 Homo sapiens |
CDS for Aldehyde oxidase-like protein (AOX2) pseudogene |
aagaattcggcacgagca LNSARA |
Wright RM. Human aldehyde oxidase. [Unpublished]. |
14 |
AF339764 Homo sapiens |
mRNA from Fetal liver spleen IMAGE:108721 |
gaattcggcacgagcggcacgagct |
Genomics 79, 635-656. 2002. |
15 |
U43527 Homo sapiens |
5'UTR for Malignant melanoma metastasis-suppressor (KiSS-1) |
(ctct)15cctcgtgccgaattcggcacgag |
J. Natl. Cancer Inst. 88, 1731-1737. 1996; Genomics 54, 145-148. 1998. |
16 |
AY029161 Homo sapiens |
3'UTR for PinX1 [L: LPTL. R: PHPT1] |
ctcgtgccgaattcggcac |
Cell 107, 347-359. 2001. |
17 |
NR_001557 Homo sapiens |
Gene Aldehyde oxidase 2 (AOX2) on Chromosome 2 |
gaattcggcacgagc |
J. Biol. Chem. 276, 46347-46363. 2001; Genome Res. 6, 807-828. 1996. |
18 |
AF039656 Homo sapiens |
Gene for neuronal tissue-enriched acidic protein (NAP-22) |
gaattcggcacgagctc |
Mol. Cells 8, 471-477. 1998. |
19 |
Z28355 Homo sapiens |
cDNA, Atrium library Human heart |
(ctct)16cgtgccgaattcggc |
C. R. Acad. Sci. III, Sci. Vie. 318, 263-272. 1995. |
|
|
|
|
|
20 |
AB030505 Mus musculus |
3'UTR for androgen-regulated homolog (Arsdr) & Mum1, and 5'UTR for Retinol dehydrogenase 11 (Rdh11) |
ctcgtgccgaattcggcacgag |
Goto and Eddy. [Direct Submission]; Diabetes 52, 2666-74. 2003. |
21 |
NM_178759 and BC032879 Mus musculus |
T-cell immunoglobulin and mucin domain containing 4 (Timd4) [L: Doc4. R: Hypot. Threo-rich region/Ig ctg prot] |
acctcgtgccgaattcggcacgag TSCRIRHE |
Eur. J. Immunol. 34, 494-03. 2004; Proc. Natl. Acad. Sci. U.S.A. 99, 16899-03. 2002. |
22 |
AJ237586 Mus musculus |
Hypothetical protein in thymocytes |
cactcgtgccgaattcggcacgag HSCRIRHE |
Immunogenetics. 50, 255-70. 1999. |
23 |
NM_026928 Mus musculus |
1810014F10Rik, fucose binding |
acctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgag TSCRIRHEASCRIRHE |
J. Biol. Chem. 278, 28173-28180. 2003; Biotechnol. Bioeng. 86, 136-148. 2004. |
24 |
AB094480 Mus musculus |
LE51 hypothetical protein |
acctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgag TSCRIRHEASCRIRHE |
Biotechnol. Bioeng. 86, 136-148. 2004. |
25 |
AF487346 Mus musculus |
Dscaml1 [L: Nucleoside diphosphate kinase homologue] |
ctcgtgccgaattcggcacgag TRAEFGTR |
Shimohata et al. Cloning and characterization of mouse Dscaml1 [Unpublished]. |
26 |
U24160 Mus musculus |
5'UTR for Dvl-2 |
gaattcggcacgagctcg |
Mech. Dev. 58, 15-26. 1996. |
27 |
L49502 Mus musculus |
Gene, mRNA and 5'UTR for Phosphoprotein (p150TSP) |
cgaattcggcacgagct |
J. Biol. Chem. 271, 6952-6962. 1996. |
28 |
AJ010792 Mus musculus |
Muc5AC protein |
gaattcggcacgagctgc EFGTSC |
Gastroenterology 118, 70-80. 2000. |
29 |
NM_012047 Mus musculus |
5'UTR for bromodomain containing 7 (also called Brd7, Bp75, Celtix1, Ptpn13ip) |
gaattcggcacgagct |
J. Cell. Physiol. 185, 269-279. 2000; FEBS Lett. 459, 291-298. 1999. |
30 |
AI607511 Mus musculus |
EST similar to Acidic ribosomal phosophoprotein |
ctcgtgccgaattcggcacgag |
Marra et al. [Unpublished]. |
31 |
AF466768 Mus musculus |
5'UTR for Monoclonal antibody BBK-1 light chain |
ggcacgaggcctcgtgccgaattcggcacgagg |
Lee et al. [Direct Submission]. |
32 |
AF071010 Mouse mammary tumor virus (MMTV) |
Putative integrase, fusion protein, insertion of proviral MMTV into mouse SH3 domain-containing protein |
ctcgtgctgaattcggcacgagga LVLNSARG |
Popken-Harris et al. MMTV in Mice. [Unpublished]; Virus Genes 23, 35-43. 2001. |
33 |
U35364 Rattus norvegicus |
Sly1 homologue |
tctcgtgccgaattcggcacgagc SRAEFGTS |
Gene 169, 293-294. 1996. |
34 |
NM_019326 Rattus norvegicus |
Gene for neurogenic differentiation 2 (Neurod2) |
gaattcggcacgagctc |
J. Neurochem. 88, 1041-1051. 2004; Biochem. Biophys. Res. Commun. 219, 526-530. 1996. |
35 |
D82868 Rattus norvegicus |
mRNA for bHLH protein |
gaattcggcacgagctc |
Biochem. Biophys. Res. Commun. 219, 526-530. 1996. |
36 |
D63834 Rattus norvegicus |
5' UTR for Monocarboxylate transporter MCT1 |
gaattcggcacgagct |
Biochem. Biophys. Res. Commun. 217, 370-377. 1995. |
37 |
NM_053484 & AJ131902 Rattus norvegicus |
3' UTR for Growth arrest specific 7 (Gas7) |
cgaattcggcacgagc |
Chao CC [Unpublished]; J. Neurosci. Res. 74, 248-54. 2003. |
38 |
NM_031626 & U14533 Rattus norvegicus |
5' UTR & 3' UTR for Nuclear receptor subfamily 1, group H, 2 (Nr1h2) |
gaattcggcacgagc & agctcgtgccgaattc |
Proc. Natl. Acad. Sci. U.S.A. 91, 10809-10813. 1994, and 92, 2096-2100. 1995. |
39 |
U07609 Rattus norvegicus |
5' UTR & 3' UTR for Na+-dependent inorganic phosphate cotransporter |
gaattcggcacgagc & agctcgtgccgaattc |
Proc. Natl. Acad. Sci. U.S.A. 91, 5607-5611. 1994. |
40 |
NM_173145 Rattus norvegicus |
5' UTR & 3' UTR for large homolog-associated protein 4 (Dlgap4) |
gaattcggcacgagc & ctcgtgccgaattc |
J. Biol. Chem. 272, 11943-11951. 1997. |
41 |
NM_134335 Rattus norvegicus |
5' UTR & 3' UTR for Myosin IXA (Myo9a) |
gaattcggcacgag & ctcgtgccgaattcg |
Baehler M. Protein Myr 7. [Unpublished]. |
42 |
NM_053770 Rattus norvegicus |
5' UTR & 3' UTR for Arg/Abl-interacting protein ArgBP2 |
gaattcggcacgag & cgtgccgaattc |
J. Biol. Chem. 274, 30914-30918. 1999. |
43 |
X57710 & D00853 Oryctolagus cuniculus |
MRNA for alpha-1-antiproteinase F |
cggcacgagctcgtgcc |
J. Biochem. 109, 158-162. 1991. |
44 |
AY141975 Papio hamadryas |
5'UTR for Epididymal protease inhibitor 2 (Eppin) |
gcacgagctcgtgccg |
Sivashanmugam et al. Baboon. [Unpublished]. |
45 |
AF147784 Canis familiaris |
Retinal-specific clusterin-like preprotein (Clul1) [L:Kiaa1191] |
actcgtgccgaattcggcacgagc TRAEFGTS |
Gene. 243, 151-160. 2000. |
46 |
NM_001003025 Canis familiaris |
Gene and mRNA for ID3 protein |
gaattcggcacgagct |
Exp. Cell Res. 279, 62-70. 2002. |
47 |
AB099113 Bos taurus |
5'UTR for mitochondrial RNA, similar to 12S rRNA |
ctcgtgccgaattcggcacgag |
Mol. Reprod. Dev. 65, 9-18. 2003. |
48 |
U83919 Bos taurus |
mRNA for Neurofilament L subunit |
gaattcggcacgagctc |
Hill et al. [Unpublished]; J Mol. Neurosci. 20, 223-32. 2003. |
49 |
L81157 Equus caballus |
Immunoglobulin mu (IgM), VDJC region |
gaattcggcacgagctca EFGTSS |
Immunogenetics 45, 386-393. 1997. |
50 |
L81159 Equus caballus |
Immunoglobulin mu (IgM), VDJC region |
aggaattcggcacgagag RNSARE |
Immunogenetics 45, 386-393. 1997. |
51 |
AF506976 Equus caballus |
3' UTR for Capping protein |
ttcggcacgagctcgtgccg |
Takafuji et al. [Unpublished]; Am J Vet Res. 63, 551-8. 2002. |
52 |
L27860 Equus caballus |
T-cell receptor DNA, V region |
tcgaattcggcacgagca SNSARA |
Immunogenetics 40, 135-144. 1994. |
53 |
NM_214016 & AF384216 Sus scrofa |
Gene for CECR1 protein |
gaattcggcacgagctc |
Gene 280, 27-36. 2001. |
54 |
L43124 Sus scrofa |
5'UTR for vascular cell adhesion molecule (VCAM) |
gaattcggcacgagct |
Biochem. Biophys. Res. Commun. 201, 805-812. 1994; Transplantation 60, 1299-1306. 1995. |
55 |
NM_214078 & AF163766 Sus scrofa |
3'UTR for P-selectin (SELP) |
gctcgtgccgaattc |
J. Immunol. 164, 3309-3315. 2000. |
56 |
AF049746 Monodelphis domestica |
Gene for Ig lambda light chain |
ggcacgagctcgtgccg |
J. Immunol. 161, 6724-6732. 1998. |
57 |
AF010497 Monodelphis domestica |
5'UTR & 3'UTR for MHC class II beta chain precursor (Modo-DAB1) |
aattcggcacgagct & agctcgtgccgaattc |
Immunogenetics 49, 461-463. 1999. |
58 |
AJ291982 Platichthys flesus |
5'UTR for 40S Ribosomal protein S15a (Rps15a) |
gaattcggcacgagc |
Aquat. Toxicol. 65, 141-157. 2003. |
59 |
NM_204873 & AJ012287 Gallus gallus |
3'UTR for Alpha tectorin (LOC395686) |
agctcgtgccgaattc |
Hear. Res. 130 (1-2), 62-74. 1999. |
60 |
NM_204412 & U01339 Gallus gallus |
5'UTR & 3'UTR for Achaete-scute complex-like 1 (ASCL1) |
gaattcggcacgagc & ctcgtgccgaattc |
Mol. Cell. Neurosci. 25, 374-382. 2004; Development 120, 769-783. 1994. |
61 |
AY775183 & AY727528 Pimephales promelas |
3' UTR for Estrogen receptor alpha |
ctcgtgccgaattcg |
Filby & Tyler. Fathead Minnow. [Unpublished]; Environ. Sci. Technol.. 38, 6314-21. 2004. |
62 |
AF179870 Rana pipiens |
Guanylate cyclase type 2 (Gc2) |
ctcgctcgtgccgaattcggcacgaga LARAEFGTR |
Mol. Cell. Biochem. 254, 9-19. 2003. |
63 |
AB178055 Rana japonica |
5'UTR for Gonadotropin alpha-subunit (GTH alpha) |
aattcggcacgaggcctcgtgccgaattcggcacgagg |
Nakano et al. Gonadotropin subunit in Frog Pituitary Gland. [Unpublished]. |
64 |
AB072909 Xenopus laevis |
5'UTR for Claudin4L2 |
ctcgtgccgaattcggcacga |
Gene Expr. Patterns 2, 23-26. 2002. |
65 |
AJ243595 Xenopus laevis |
5'UTR for homeodomain transcription factor XPitx2B |
ccgaattcggcacgagctcg |
Mech. Dev. 90, 41-51. 2000. |
66 |
AF115498 Xenopus laevis |
Smad1 antagonistic effector (Sane)[R:Man1] |
ctcgtgccgaattcggcacgaggt LVPNSARG |
J. Biol. Chem. 278, 428-437. 2003. |
67 |
AF069737 Xenopus laevis |
Gene for notchless (Nle), a Notch activity modulator |
gaattcggcacgagctc |
EMBO J. 17, 7351-7360. 1998. |
68 |
AF419156 Xenopus laevis |
Map kinase-interacting kinase |
cgaattcggcacgag RIRHE |
Curr. Biol. 12, 105-114. 2002. |
69 |
AF419153 Xenopus laevis |
Mitotic phosphoprotein 67 [L: Map kinase-interacting kinase] |
ttcgaattcggcacgagg FEFGTR |
Curr. Biol. 12, 105-114. 2002. |
70 |
AF419149 Xenopus laevis |
Mitotic phosphoprotein 22 |
ttcgaattcggcacgagt FEFGTS |
Curr. Biol. 12, 105-114. 2002. |
71 |
AJ249625 Paracentrotus lividus |
Gene for for Chaperonin (Hsp60) |
gaattcggcacgagctc |
Cell Stress Chaperones 5, 87-89. 2000. |
72 |
AY027936 Salmo salar |
Hyperosmotic protein 21 (P21) [R: ring-box 1, Rbx1] |
ctcgtgccgaattcggcacgagcg LVPNSARA |
Am. J. Physiol. Regul. Integr. Comp. Physiol. 282, R1643-53. 2002. |
73 |
AY190729 Pagrus major |
Ribosomal protein L10a |
gcacgaggctcgtgccgaattcggcacgag ARGSCRIRHE |
Aquaculture 240, 115-130. 2004. |
74 |
NM_199765 Danio rerio |
PHD finger protein 6 (phf6). |
tctcgtgccgaattcggg SRAEFG |
Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
75 |
BC044163 Danio rerio |
Similar to RIKEN cDNA 4931428F02 |
tctcgtgccgaattcggg SRAEFG |
Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
76 |
AJ431209 Carassius auratus |
5'UTR [& CDS] for Proopiomelanocortin (Pomc) |
gaattcggcacgagc [& cctcggcacgagctc PRHEL, base changes] |
Regul. Pept. 115, 101-113. 2003. |
77 |
AF013800 Salvelinus alpinus |
5'UTR for Metallothionein A (MT A) |
gaattcggcacgagct |
Mar. Environ. Res. 46 (1-5), 551-554. 1998. |
78 |
AY713401 Crassostrea gigas |
Calmodulin, calcium-dependent protein kinase |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Huvet et al. ESTs. [Unpubl.]; Gene 343, 211-20, 2004. |
79 |
AY026258 Biomphalaria glabrata |
Thioredoxin peroxidase BgTPx |
aattcggcacgagca NSARA |
Cousi n et al. [Unpubl.]; Mol Biochem Parasitol. 126, 181-91. 2003. |
80 |
AY069220 Drosophila melanogaster |
Gutfeeling (Guf, GH26763), Longest ORF [R: Ornithine decarboxylase antizyme] |
gctcgtgccgaattcggcacgaga ARAEFGTR |
Stapleton et al. [Direct Submission ] Genome Biol. 3, RESEARCH0080. 2002; Genome Res. 12, 1294-300. 2002. |
81 |
U48394 Drosophila melanogaster |
Gene for ribosomal protein S5 homolog (M(1)15D) |
gaattcggcacgagct |
Genet ics 144, 215-228. 1996. |
82 |
AF242203 Drosophila melanogaster |
5'UTR for Pins protein (Pins) |
gaattcggcacgagc |
Curr. Biol. 10, 353-362. 2000. |
83 |
AF005852 Drosophila yakuba |
Gene for Anon1G5 |
cgaattcggcacgagct |
Proc. Natl. Acad. Sci. U.S.A. 94, 9746-9750. 1997. |
84 |
AY295775 Depressaria pastinacella |
Cytochrome P450 (CYP9A7) |
atcgaattcggcacgagg IEFGTR |
Insect Mol. Biol. 13, 603-613. 2004. |
85 |
XM_312915 Anopheles gambiae |
ENSANGP00000014770 (ENSANGG00000012281) |
tacgtgccgaattcggcc YVPNSA [ base changes] |
The Anopheles Genome Sequencing Consortium |
86 |
AB180424 & AB180425 Plutella xylostella |
5'UTR for Ribosomal proteins L21 & S28 |
ggcacgaggcctcgtgccgaattcggcacgagg |
Eum et al. EST Analysis of moth. [Direct Submission] |
87 |
AF014463 Phoneutria nigriventer |
Gene & mRNA for Neurotoxic protein (Pn2-5A) |
ctcgtgccgaattcgg |
Toxicon. 36,1843-50. 1998. |
88 |
AF026060 Chironomus tentans |
Telomeric region |
gaattcggcacgagctc |
Kamnert et al. [Direct Submission]; Insect Mol. Biol. 11, 167-74. 2002; J. Mol. Evol. 46, 562-70. 1998. |
89 |
Y11879 Arenicola marina |
Trypsin-like protease |
cgtgccgaattcggcacgagt RAEFGTS |
Eberhardt and Peterson. [Direct Submission]. |
90 |
Y08489 Schistosoma mansoni |
Serine-rich protein |
gaattcggcacgagcttt EFGTSF |
Schuessler P. Molecules in the male-female interaction of S.mansoni. [Unpublished]. |
91 |
AY223273 Schistosoma japonicum |
hypothetical protein UBX domain |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Nat. Genet. 35, 139-147. 2003. |
92 |
AB104619 Polyplastron multivesiculatum |
Cellulase (celA) |
gcacgagctcgtgccgaattcggcacgagg ARARAEFGTR |
Takenaka et al. Fibrolytic enzyme cDNA from rumen ciliates. [Unpublished]. |
93 |
AY029595 Schizophyllum commune |
Putative beta-glucan synthesis-associated protein (bgs1) |
gcacgagctcgtgccgaattcggcacgag ARARAEFGTS |
Guettler et al. Bgs1 gene. [Unpublished]; Fungal Genet Biol. 39, 191-8. 2003. |
94 |
AJ005572 Plasmodium falciparum |
Hypothetical protein [R: karyopherin beta (KP1)] |
acgagctcgtgccgaattcggcacgag TSSCRIRHE |
Shams-Eldin et al. [Unpublished] |
95 |
S79293 & D16136 Dirofilaria immitis |
Filarial common antigen [R: Cloning Vector, i.e., pUC & Phage f1 deriv.] |
gctcgtgccgaattc ARAEF |
Chin. Med. J. 108, 466-468. 1995. |
96 |
AB002777 Entamoeba histolytica |
5'UTR for ribosomal protein S29 |
ctcgtgccgaattcggcacgag |
Biochem. Biophys. Res. Commun. 236, 611-615. 1997. |
97 |
AB002794 and AB002739 Entamoeba histolytica |
Small subunit rRNA |
ctcgtgccgaattcggcacgag |
Biochem. Biophys. Res. Commun. 236, 611-615. 1997. |
98 |
AB002728 Entamoeba histolytica |
Elongation factor 1 alpha (Ef1A) |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Biochem. Biophys. Res. Commun. 236, 611-15. 1997. |
99 |
AB002741 Entamoeba histolytica |
Amoebapore C homologue |
ctcgtgccgaattcggcacgag SCRIRHE |
Biochem. Biophys. Res. Commun. 236, 611-15. 1997. |
100 |
AB002731 Entamoeba histolytica |
Histone H1 |
ctcgtgccgaattcggctcgaggc LVPNSARG |
Biochem. Biophys. Res. Commun. 236, 611-15. 1997. |
101 |
AJ496453 Laminaria digitata |
Mannuronan C-5-epimerase (Epi) |
gaattcggcacgagc EFGTS |
Plant Physiol. 133, 726-735. 2003. |
102 |
AF273835 Caenorhabditis elegans |
Nuclear receptor NHR-91 |
ctcgtgccgaattcggcacgag SCRIRHE |
Robinson-Rechavi et al. HNF4 in nematodes. [Unpublished] |
103 |
X68492 , L03711 & L04287 Caenorhabditis elegans |
Gene and mRNA for Rac1 homologue, a small ras-related protein |
gaattcggcacgagcttgtgc |
J. Biol. Chem. 268, 320-324. 1993. |
104 |
AB047581 Hydra vulgaris |
Gene, mRNA & 5' UTR for homologue CnDMC1 |
gagctcgtgccgaatt |
Mochizuki & Fujisawa. [Direct Submission]. |
105 |
L22612 Hydra vulgaris |
5' UTR & 3' UTR for tyrosine kinase receptor |
gaattcggcacgagct & gctcgtgccgaattc |
J. Biol. Chem. 275, 10323-10330. 2000. |
106 |
AF306544 Hydra vulgaris |
3' UTR for Serum response factor (SRF) |
gctcgtgccgaattc |
Dev. Biol. 236, 304-315 2001. |
107 |
AJ250043 Anisakis simplex |
Hypothetical protein |
cggcacgagctcgtgccgaattcggcacgagga RHELVPNSARG |
Arrieta et al. Anisakis simplex for a 12 kD protein. [Unpublished] |
108 |
AY057457 Stizostedion vitreum |
Major histocompatibility class I receptor |
cctcgtgccgaattcggcacgagg PRAEFGTR |
Immunogenetics. 53, 760-769. 2001. |
109 |
Y15794 Theileria annulata |
Spm1 protein |
actcgtgccgaattcggcacgagg TRAEFGTR |
Mol. Biochem. Parasitol. 100, 135-140. 1999. |
110 |
AF332963 Polytomella sp. |
5'UTR for Ferrochelatase |
cctcgtgccgaattcggcacgaggcctcgtgccgaattcggcacgagg |
Atteia et al. [Unpublished]. |
111 |
AJ416378 Polytomella sp. |
5'UTR for Cyc |
ggcacgaggcctcgtgccgaattcggcacgaggga |
Atteia A. [Unpublished]. |
112 |
AY093683 Suaeda maritima |
5'UTR for Mitogen-activated protein kinase kinase |
ggcacgaggcctcgtgccgaattcggcacgaggga |
Yin et al. [Unpublished]. |
113 |
AF043384 Pleuronectes americanus |
Beta actin (ACT1) |
cgagctcgtgccgaattc ELVPNS |
J. Appl. Ichthyol. 15, 80-86. 1999; Mar Biotechnol (NY). 1, 458-0464. 1999. |
114 |
AY206000 Malva pusilla |
Glutathione S-transferase F1 |
aggaattcggcacgagca RNSARA |
Goodwin et al. [Unpublished]. |
115 |
AF499715 Thellungiella halophila |
5'UTR for Lipid transfer protein 4-like protein |
aattcggcacgaggcctcgtgccgaattcggcacgagg |
Plant Sci. 166, 609-616. 2004. |
116 |
AF279454 Lycopersicon esculentum |
Sesquiterpene synthase 2 (Sstle2) |
ctcgtgccgaattcggcacgagct LVPNSARA |
Plant Cell. 12, 2283-94. 2000. |
117 |
AF332957 Lycopersicon esculentum |
Fructose-1,6-bisphosphate aldolase |
aattcggcacgagctc NSARAQ |
Zurek and Rayle. Auxin Regulation. [Unpublished]; Plant Physiol. 104, 505-513. 1994. |
118 |
AY157614 Ficus carica |
5'UTR for Chitinase |
ggcacgaggcctcgtgccgaattcggcacgagg |
Plant Cell Physiol. 44, 412-414. 2003. |
119 |
AY089962 Solanum tuberosum |
Cysteine proteinase inhib. Prec. P7G8, Kunitz-type |
tcgtgccgaattcggcacgagtt VPNSARV |
Mol. Genet. Genomics 269, 526-534. 2003. |
120 |
AY098939 Solanum tuberosum |
Amino-cyclopropane-1-carboxylate oxidase (Aco) [ESTs in both sides] |
gctcgtgccgaattcggcacgagc ARAEFGTS |
J. Exp. Bot. 53, 2455-7. 2002. |
121 |
X93160 Spinacia oleracea |
5' UTR & 3' UTR for Ribosomal protein L4 |
aattcggcacgagctc & agctcgtgccgaattc |
J. Biol. Chem. 273, 3980-3985. 1998. |
122 |
AY324804 Nicotiana tabacum |
mRNA-binding protein (csp41), nuclear gene for chloroplast product |
cactcgtgccgaattcggcacgag HSCRIRHE |
Plant J. 36, 842-852. 2003; Nucleic Acids Res. 31, 4317-4325. 2003. |
123 |
AF242734 Capsicum annuum |
Putative proteinase inhibitor II |
cccgtgccgaattcggcacgaa PVPNSARK |
Plant Sci. 161, 727-737. 2001. |
124 |
AF467542 Triticum aestivum |
Gene for putative aldehyde dehydrogenase Wis1 |
gaattcggcacgagctc |
Plant Physiol. 129 (1), 169-180. 2002. |
125 |
M95818 & M95819Triticum aestivum |
5'UTR for initiation factor isozyme 4F p28 subunit |
gaattcggcacgagctc |
J. Biol. Chem. 267, 23232-23236. 1992. |
126 |
AY387686 Triticum aestivum |
5'UTR for harpin binding protein 1 (HrBP1-1) |
gaattcggcacgagct |
Song et al. [Unpublished]. |
127 |
BT009402 Triticum aestivum |
mRNA for clone wlm96.pk046.j8:fis |
ctcgtgccgaattcggcacgagctcgtgccgaattcggcacgagg |
Tingey et al. [Direct Submission]. |
128 |
NM_188717 Oryza sativa |
Hypothetical protein |
ggcgagctcgtgccgaattag GELVPN |
The NCBI Genome Assembly Consortium [Submitted: 01-JUL-2004] |
129 |
AF001501 Oryza sativa |
MIRCH38 chitinase |
ggcacgagctcgtgccgaattcggcacgag GTSSCRIRHE |
Yun et al. Rice chitinase. [Unpublished]; Mol. Cells. 17, 10-6. 2004. |
130 |
Y12594 Oryza sativa |
Fd-GOGAT, 2 hours anaerobic coleoptiles |
gaattcggcacgagctca EFGTSS |
Mattana et al. [Unpublished, Submitted 1997] |
131 |
AF290415 Zea mays |
Crs1, splicing nuclear gene for chloroplast |
attcggcacgagcga IRHER |
RNA 7, 1227-1238. 2001. |
132 |
AF126054 & AY110620 Zea mays |
mRNA, 5'UTR for Rop3 small GTP binding protein & CL1205_2 |
gaattcggcacgagct |
Biochem. Biophys. Res. Commun. 272, 783-788. 2000; Plant Physiol. 133, 1791-808. 2003; Hainey et al. |
133 |
BT016274 & BT016336 Zea mays |
mRNA from Contigs [i.e., L: Starch branching enzyme II. R: Polyubiquitin] |
cctcgtgccgaattcggcacgaggcctcgtgccgaa-tcggcacgagg |
Genome Res. 14(10A): 1932-7. 2004. |
134 |
Y10252 Lotus corniculatus var. japonicus |
5'UTR for Pantoate-beta-alanine ligase (PanC) |
gaattcggcacgagctc |
Biochem. J. 341 (Pt 3), 669-678. 1999. |
135 |
AJ271664 Cicer arietinum |
Hypothetical protein, ORF, putative metallophosphatase (ppd4) |
ctcgtgccgaattcggcacgagt RAEFGTS |
Dopico et al. cDNA in chickpea epicotyls. [Unpublished]; Plant Mol Biol. 35, 433-42. 1997. |
136 |
AJ271659 Cicer arietinum |
Serine carboxipeptidase |
gagcggcacgagctcgtgccgac ERHELVPT |
Dopico et al. Serine carboxipeptidase in chickpea epicotyls. [Unpublished]. |
137 |
X88864 Medicago sativa |
5'UTR for for cyclin protein (CycMs4) |
gaattcggcacgagctc |
Plant Cell 7, 1847-1857. 1995. |
138 |
U14956 Vicia faba |
5'UTR for Ferredoxin NADP+ reductase precursor (fnr) |
gaattcggcacgagct |
Lax and Cary. [Unpublished]. |
139 |
AY220737 Hordeum vulgare |
lipoxygenase 1 protein (LOXA) |
gctcgtgccgaattcggcacgagg ARAEFGTR |
Mol. Plant Microbe Interact. 16, 893-902. 2003. |
140 |
AF034387 Arabidopsis thaliana |
AFT protein |
gctcgtgccgaattcggcacgagc ARAEFGTS |
Plant Physiol. 117, 1526-1526. 1998. |
141 |
M90510 Arabidopsis thaliana |
mRNA, 5'UTR for thaumatin-like |
ggcacgagctcgtgcaattcggccgaattcggcacgag |
Plant Cell 4, 645-656. 1992. |
142 |
AF001136 Pinus radiata |
5'UTR & CDS for Zinc finger protein (PrCO) |
ggcacgagctcgtgccgaattcggcacgagcg & gcctcgtgccgaattcggcacgagctc ASCRIRHEL |
Mouradov et al. [Direct Submission]; Plant Physiol. 117, 55-62. 1998. |
143 |
U31309 Pinus taeda |
Chitinase homolog LP 6 (9th CDS) |
ctcgtgccgaattcggca LVPNSA |
Plant Mol Biol. 31, 693-9. 1996. |
144 |
AY098893 Plastid Citrus hybrid cultivar |
Plastidic ATP/ADP transporter |
gaattcggcacgagctta EFGTSL |
Planta 217, 11-20. 2003. |
145 |
AF195867 Vitis vinifera |
Alcohol dehydrogenase 7 (Adh7) [R: ADH6 and ADH2] |
actcgtgccgaattcggcacgagctcgtgccgaattcggcacgag TRAEFGTSCRIRHE |
Plant Physiol. 122, 619. 2000. |
146 |
NM_214643 & AY187547 Strongylocentrotus purpuratus |
5'UTR for heat shock protein Gp96 |
gccgaattcggcacgag |
Dev. Comp. Immunol. 27, 449-464. 2003; J. Immunol. 156, 593-602. 1996. |
147 |
U22507 Heliocidaris tuberculata |
5'UTR for cytoplasmic actin type III (htcyIII) |
attcggcacgagctcg |
Mol. Biol. Evol. 14, 654-665. 1997. |
148 |
AF015712 Dictyostelium discoideum |
Kinesin-related protein K2 |
atccgaattcggcacgag IRIRHE |
de Hostos et al. [Direct Submission]; J. Biol. Chem. 273, 793-9. 1998. |
149 |
AJ006788 Coprinus cinereus |
RedA |
gaattcggcacgagctca EFGTSS |
Brander KA [Unpublished]. |
150 |
U44431 Trametes versicolor |
5'UTR for laccase IV (lccIV) |
ggcacgagctcgtgccg |
Gene 196, 113-119 1997. |
Related Sequences Included for Comparison (Predicted, Genomic or Prokaryotic) |
||||
A |
NM_173552 & BC037293 Homo sapiens |
Predicted Hypothetical protein MGC33365 |
ttcggcacgagctggtgccgc FGTSWCR |
Nat. Genet. 36, 40-45. 2004; Proc. Natl. Acad. Sci. U.S.A. 99, 16899-16903. 2002. |
B |
XM_147036 Mus musculus |
Predicted RIKEN cDNA 1190002N15 |
ttcggcacgagctggtgccgt FGTSWCR |
Model Refseq, Gnomon gene prediction plus EST evidence |
C |
XM_236493 Rattus norvegicus |
Predicted Similar to Ab2-095 (Loc315891) |
ttcggcacgagctggtgccgc FGTSWCR |
Model Refseq, Gnomon gene prediction plus EST evidence |
D |
AC103936 Mus musculus |
Chromosome 9 |
ttcggcacgagctggtgccg |
Birren et al. [Direct Submission]; Nature 420, 520-62. 2002; Nat. Genet. 22, 388-93. 1999. |
E |
AC117379 Homo sapiens |
3 BAC RP11-392C7 (Roswell Park CIHBAC Library), complete sequence |
cggcaccagctcgtgccgaa |
Muzny et al. [Direct Submission]. |
F |
AL929103 & CR318657 Danio rerio |
Complete Sequence |
gctcgtgccgaattc & ctcgtgccgaattc |
Almeida J. [Direct Submission]; Barker G. [Direct Submission]. |
G |
AE008692 Zymomonas mobilis |
Complete Genome |
tgccgaattcggcac (plus at least 3 more smaller, to 12 b, instances) |
Nat Biotechnol. 2004 Dec 12; [Epub ahead of print]. |
H |
AE017172 & AE017178 Porphyromonas gingivalis |
2 Sections of the Complete Genome |
ccgaattcggcacgag (plus at least 4 more smaller, to 12 b, instances) |
J. Bacteriol. 185, 5591-5601. 2003. |
I |
CP000010 Burkholderia mallei |
Chromosomes, complete sequences |
acgagctcgtgccga (plus at least 50/Ch, smaller, to 12 b, instances) |
Proc. Natl. Acad. Sci. U.S.A. 101, 14247-14251. 2004. (er). |
J |
BX571965 & BX571966 Burkholderia pseudomallei |
Chromosomes 1 & 2, complete sequence |
ttcggcacgagctcg (plus at least 30/Ch, smaller, to 12 b, instances) |
Proc. Natl. Acad. Sci. U.S.A. 101, 14240-14245. 2004. |
K |
AE016994 Chlamydophila caviae |
Sections of the Complete Genome |
cggcacgagctcgtg & ttcggcacgagct |
Nucleic Acids Res. 31, 2134-2147. 2003. |
L |
AY307892 Uncultured Actinobacterium |
rRNA of Actinomycete |
cacgagctcgtgccg |
Piza & Manfio. Actinomycete diversity. [Unpublished]. |
M |
STRSTRH Streptococcus pneumoniae |
3' UTR for Beta-N-acetylhexosaminidase (strH) |
agctcgtgccgaattc |
J. Biol. Chem. 270, 8805-8814. 1995. |
N |
BX572599 Rhodopseudomonas palustris |
Segment of the Complete Genome |
gtgccgaattcg , gccgaattcggca , cgtgccgaattcggc |
Nat. Biotechnol. 22, 55-61. 2004. |
O |
AE011864 Xanthomonas axonopodis |
Section 242 of 469 of the complete genome |
Acgagctcgtgccga |
Nature 417, 459-463. 2002. |
P |
XM_323355 & XM_323891 Neurospora crassa |
Genome of N. crassa strain OR74A |
cgagctcgtgccgaa & cggcacaagctcgtgccga |
Nature 422, 859-868. 2003. |
* The last example-sequences (A-P), from bacteria, genomes and predicted sequences are included for comparison purposes. Note: The actual palindromes within the genes may be longer than the ones presented here.
Additional Evidence:Zipped Word document with examples taken from the Affymetrix Microarrays.
Zipped Excel file with examples taken from the Genbank database.
Notes:Tasters of the Word (YouTube), videos recientes: "Astronomía y Nacimiento de Jesucristo: Once de Septiembre Año Tres A.C.", "Estudio sobre Sanidades" (en 20 episodios), "Jesus Christ, Son or God?":
Tasters of the Word (the blog, with: "Astronomy and the Birth of Jesus Christ"):